CMV-MCS-3FLAG-SV40-Neomycin

Map

Vectorinformation ：

General：5508bp

CMV promoter：4269-4856

MCS：4932- 5037

3FLAG：5042-5113

BGH poly A：5145-5369

f1 ori：5415- 335

SV40 promoter：340-683

Neomycin：745- 1539

SV40 poly A：1713-1843

pUC ori：2896- 2226

Ampicillin：3901-3041

AmpR_promoter：3971-3943

Primer locations and sequences：

SEQ -F（4806-4826）：CGCAAATGGGCGGTAGGCGTG

SEQ -R（5239-5219）：TTATTAGGAAAGGACAGTGGG

Recovery

1. Obtain an LB agar plate     with the appropriate antibiotic.

2. Using a sterile pipette     tip, touch the bacteria growing within the punctured area of the stab     culture. (A sterilized wire loop or sterile toothpick can be used in place     of a sterile pipette tip.)

3. Run this tip lightly over     a section of the plate, as shown in the figure, to create streak #1.

4. Using another sterile     pipette tip, pass through streak #1 and spread the bacteria over a second     section of the plate, to create streak #2.

5. Using a third sterile     pipette tip, pass through streak #2 and spread the bacteria over the last     section of the plate, to create streak #3.

6. Grow overnight in a 37 ^o     C incubator (unless a different growth temperature is indicated on the     plasmid datasheet).

7. In the morning, single     colonies should be visible. If the bacterial growth is too dense,     re-streak onto a new agar plate to obtain single colonies.