Plant Showing 1 to 2 of 2 entries records per page Search table: Previous Next Plasmid Gene/Insert Promoter Selectable Marker PI Publication pBUN6A11 dCas9-VP64 (Synthetic), gRNA scaffold (Synthetic) Ubi1p, OsU3p Bar Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. Add to Cart pHSN6A01 dCas9-VP64 (Synthetic), gRNA scaffold (Synthetic) 2×35Sp, AtU6-26p Hygromycin Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. Add to Cart dCas9-FokI A catalytically inactive Cas9 (dCas9) fused to half of the FokI nuclease. When FokI dimerizes it can generate double strand breaks (DSBs, Cut) at specific sequences. Two unique gRNAs are required to target the dCas9-FokI to a region of the genome. In order for FokI to dimerize, the two halves, each guided by a unique gRNA, must bind ~30bp apart. This technique combines the reduced off-target effects of the dual-nickase system with the additional care of the dimerization of FokI. Mammalian Showing 1 to 2 of 2 entries records per page Previous Next ID Plasmid Gene/Insert Vector Type Promoter PI Publication 52970 FokI-dCas9 Fok1 fused to dCas9 (Other) Mammalian Expression, CRISPR CMV Liu Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2909. 53369 pSQT1601 hCsy4-T2A-NLS-hFokI-dCas9-NLS Mammalian Expression, CRISPR CAG Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Drosophila Showing 1 to 2 of 2 entries records per page Search table: Previous Next ID Plasmid Gene/Insert Vector Type Promoter PI Publication 62210 pnos-Fok1:dCas9-nos Fok1-dCas9 Insect Expression nanos Bullock CRISPRflydesign(unpublished) 62211 pAct-Fok1:dCas9 Fok1-dCas9 Insect Expression act5C Bullock CRISPRflydesign(unpublished) Purify A catalytically inactive Cas9 (dCas9) fused to an epitope tag(s) can be used to purify genomic DNA bound by the gRNA. Design your gRNA sequence to direct the dCas9 to a specific genomic sequence. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9. Mammalian Showing 1 to 5 of 5 entries records per page Search table: Previous Next Plasmid Gene/Insert Vector Type Promoter Selectable Marker PI Publication 3xFLAG-dCas9/pCMV-7.1 3xFLAG-dCas9 Mammalian Expression, CRISPR CMV Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Aug 11. pii: S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013. 3xFLAG-dCas9/pMXs-neo 3xFLAG-dCas9 (Synthetic) Mammalian Expression, Retroviral, CRISPR LTR Neomycin Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 3xFLAG-dCas9/pMXs-puro 3xFLAG-dCas9 (Synthetic) Mammalian Expression, Retroviral, CRISPR LTR Puromycin Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 3xFLAG-dCas9/pMXs-I2 3xFLAG-dCas9 (Synthetic) Mammalian Expression, Retroviral, CRISPR LTR human CD2 Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 3xFLAG-dCas9/pMXs-IG 3xFLAG-dCas9 (Synthetic) Mammalian Expression, Retroviral, CRISPR LTR enhanced GFP Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Yeast Showing 1 to 1 of 1 entries records per page Search table: Previous Next Plasmid Gene/Insert Vector Type Promoter Selectable Marker PI Publication 3xFLAG-dCas9/pTEF1p-CYC1t 3xFLAG-dCas9 (Synthetic) Yeast Expression, CRISPR TEF1 promoter TRP1 Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR.Biochem Biophys Res Commun. 2013 Aug 11. pii: S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013. Visualize A catalytically inactive Cas9 (dCas9) fused to a fluorescent protein (FP) can be used to visualize specific genomic loci using fluorescent microscopy in living cells. Design your gRNA sequence to direct the dCas9-FP fusion to a specific genomic sequence. Potential target locations can include unique or repetitive regions. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9-FP protein. Mammalian Showing 1 to 13 of 13 entries records per page Search table: Previous Next Plasmid Gene/Insert Vector Type Promoter Selectable Marker PI Publication pHR-SFFV-dCas9-BFP dCas9-BFP fusion (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR SFFV Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. pSLQ1658-dCas9-EGFP dCas9 fuse to EGFP (Homo sapiens) Mammalian Expression, Retroviral, CRISPR MSCV LTR promoter Puromycin Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. pHAGE-EFS-dCas9-GFP Sp dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR EFS Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-SSFV-dCas9-GFP Sp dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR SSFV Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-dCas9-3XGFP Sp dCas9 (Synthetic) Mammalian Expression, Lentiviral CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-dCas9-3XmCherry Sp dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-dCas9-GFP Sp dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nls-st1dCas9-3nls-3XGFP St1 dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nls-st1dCas9-3nls-3XGFP-2nls St1 dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nls-st1dCas9-3nls-3XGFP-nls St1 dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2 St1 dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nmdCas9-3XGFP Nm dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. pHAGE-TO-nmdCas9-3XmCherry Nm dCas9 (Synthetic) Mammalian Expression, Lentiviral, CRISPR CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Screen (libraries) The CRISPR/Cas9 system has quickly become an important tool for the genome engineering community, but the technique has primarily been limited to focused gene knock-outs and direct transfection protocols. The vectors and sgRNA libraries described below expand upon the CRISPR family of plasmids by A) offering a lentivirus-based mechanism for sgRNA delivery and B) providing a means for large scale functional screens. Type ID Item Library 60956 CRISPRa Library Add to Cart Library 62217 CRISPRi Library Add to Cart Plasmid 60955 pU6-sgRNA EF1Alpha-puro-T2A-BFP: Lentiviral expression of an sgRNA sequence, with co-expression of puromycin and BFP for selection. Parental vector for CRISPRa and CRISPRi libraries. Add to Cart Plasmid 60903 pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP: Lentiviral expression of dCas9 fused to 10 GCN4 peptides, co-expressing BFP. A component of the SunTag system used in CRISPRa experiments. Add to Cart Plasmid 60904 pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS: Lentiviral expression of a single-chain variable fragment (scFv) antibody fused to VP64 that binds GCN4 peptides in the SunTag system. Co-expresses GFP. Used in CRISPRa experiments. Add to Cart Plasmid 46911 pHR-SFFV-dCas9-BFP-KRAB: Lentiviral expression of a dCas9-BFP-KRAB fusion protein, used for stable expression in CRISPRi experiments. Add to Cart Feng Zhang Lab (libraries targeting human and mouse genes) SAM library The synergistic activation mediators (SAM) library is now available. CRISPR/Cas9 Synergistic Activation Mediator (SAM) is an engineered protein complex for the transcriptional activation of endogenous genes. The SAM library consists of 3 unique sgRNAs targeting each human RefSeq coding isoform in the proximal promoter (> 90% of sgRNAs are targeted to the first 200bp upstream of the transcription start site of their target). The total library size is 70,290 guides. For SAM gain-of-function screening, this sgRNA library has to be combined with two additional SAM constructs – dCas9-VP64 and MS2-P65-HSF1. These are provided along with the library. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O & Zhang F. Nature doi:10.1038/nature14136 (2014)PubMed Type ID Item Plasmid 61425 dCas9-VP64 plasmid page: A nucleolytically inactive Cas9-VP64 fusion Included Plasmid 61426 MS2-P65-HSF1 plasmid page: Expresses the activation helper protein Included Library Human SAM Library, 3 plasmid system Order Here GeCKO v2 library The human genome-scale CRISPR-Cas9 knockout (GeCKO) v2 library consists of 122,417 unique guide sequences targeting 19,052 human genes and including 1000 control (non-targeting) sgRNAs. The murine library consists of 130,209 unique guide sequences targeting 20,661 murine genes. There are two versions of each library. The lentiCRISPR v2 still expresses both Cas9 and the sgRNA on the same plasmid but can produce 10-fold higher titers than the original lentiCRISPR backbone. The 2 vector format uses lentiGuide-Puro as a backbone and produces an even higher titer but must be used with cells that already contain Cas9. The lentiCas9-Blast vector is provided with this 2-plasmid version of the GeCKO library. Type ID Item Plasmid 52961 lentiCRISPR v2: Lentiviral expression of hSpCas9 and sgRNA (replaces Addgene plasmid 49535) Backbone for 1 plasmid system Plasmid 52962 lentiCas9-Blast: Lentiviral expression of human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. Ships with 2 plasmid system Plasmid 52963 lentiGuide-Puro: Lentiviral expression of S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. Backbone for 2 plasmid system Library Human GeCKO v2 Library, 1 plasmid system Order Here Library Human GeCKO v2 Library, 2 plasmid system Order Here Library Mouse GeCKO v2 Library, 1 plasmid system Order Here Library Mouse GeCKO v2 Library, 2 plasmid system Order Here David Sabatini Lab / Eric Lander Lab (targets human genes) The library described in this article consists of 73,151 sgRNA plasmids that cover a total of 7,114 human genes and include 100 non-targeting controls. The library has been separated into 6 distinct enriched sub-pools: 4 pools enriched for gene targets of known function (kinases, cell cycle proteins, nuclear proteins, and ribosomal proteins), 1 pool that targets genes of unknown function, and 1 control pool. Note that though each sub-pool is enriched for their respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. There are two lentiviral vectors associated with this paper, one expressing Cas9 (pCW-Cas9) and the sgRNA backbone (pLX-sgRNA). Genetic Screens in Human Cells Using the CRISPR/Cas9 System. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2013 Dec 12.PubMed. Type ID Item Plasmid 50661 pCW-Cas9: Inducible lentiviral expression of SpCas9. Add to Cart Plasmid 50662 pLX-sgRNA: Lentiviral expression of AAVS1-targeting sgRNA which can be replaced with custom sgRNA. Add to Cart Library 51043 Human Lentiviral sgRNA Library - Enriched Against Proteins of Unknown Function Add to Cart Library 51044 Human Lentiviral sgRNA Library - Enriched Against Kinases Add to Cart Library 51045 Human Lentiviral sgRNA Library - Enriched Against Ribosomal Proteins Add to Cart Library 51046 Human Lentiviral sgRNA Library - Enriched Against Cell Cycle Proteins Add to Cart Library 51047 Human Lentiviral sgRNA Library - Enriched Against Nuclear Proteins Add to Cart Library 51048 Human Lentiviral sgRNA Library - Enriched Against Control Proteins (most diverse pool) Add to Cart Kosuke Yusa Lab (targets mouse genes) The library described in this article consists of 87,897 unique gRNA plasmids, targeting 19,150 mouse protein coding regions. The library is designed for lentiviral expression in mouse cells. Genome-wide Recessive Genetic Screening in Mammalian Cells with a Lentiviral CRISPR-guide RNA Library. Koike-Yusa H, Li Y, Tan E-P, Del Castillo Velasco-Herrera M, Yusa K. Nat Bioetchnology . 2013 doi:10.1038/nbt.2800. PubMed . Nat Biotech . Type ID Item Plasmid 50946 pKLV-U6gRNA(BbsI)-PGKpuro2ABFP : empty gRNA expression vector for lentiviral production. Add to Cart Library 50947 Genome-wide mouse lentiviral CRISPR gRNA library Add to Cart Feng Zhang Lab (targets human genes) The genome-scale CRISPR-Cas9 knockout (GeCKO) library originally described in Shalem*, Sanjana*, et al., Science 2014. The original library is discontinued and an updated version of this library is now available. Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science. 2013 Dec 12. PubMed. Type ID Item Plasmid 49535 Lentiviral expression of hSpCas9 and sgRNA (lentiCRISPR v2 available here) Discontinued Library 51241 Human GeCKO Lentiviral sgRNA Library (Human and Mouse GeCKO v2 available here) Discontinued Validated gRNAs The table below lists experimentally validated S. pyogenes gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that you determine if your cell type contains the target sequence before using any of these gRNA plasmids and review the publication associated with each plasmid for more information on how it was originally used. Validated gRNA Plasmids Showing 1 to 240 of 240 entries records per page Search table: Previous Next Plasmid Gene/Insert Vector Type PI Publication gRNA_AAVS1-T1 gRNA_AAVS1-T1 Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart gRNA_AAVS1-T2 gRNA_AAVS1-T2 Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart gRNA_GFP-T1 gRNA_GFP-T1 Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart gRNA_GFP-T2 gRNA_GFP-T2 Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart p426-SNR52p-gRNA.CAN1.Y-SUP4t CAN1.y gRNA (Saccharomyces cerevisiae) Yeast Expression, CRISPR Church Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res Add to Cart pLX-sgRNA sgAAVS1 Mammalian Expression, Lentiviral, CRISPR Sabatini Genetic screens in human cells using the CRISPR-Cas9 system.Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. Add to Cart pSLQ1651-sgTelomere(F+E) Optimized sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System.Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Add to Cart PU6::unc-119_sgRNA unc-119 targeting sgRNA (Synthetic) CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. Add to Cart pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro humanized S. pyogenes Cas9 Mammalian Expression, CRISPR Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems.Science. 2013 Jan 3. Add to Cart lentiCRISPR - EGFP sgRNA 1 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 1 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart pICH86966::AtU6p::sgRNA_PDS AtU6p::sgRNA_PDS (Synthetic) CRISPR ; Plant expression Kamoun Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. Add to Cart pU6-sgGFP-NT1 sgGFP-NT1 Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pUC119-gRNA guide RNA targeting AtPDS3 (Arabidopsis thaliana) CRISPR ; Plant expression Sheen Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. Add to Cart pX330-Cetn1/1 Cetn1 sgRNA1 (Synthetic), humanized S. pyogenes Cas9 (Other) Mammalian Expression, CRISPR Ikawa Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. Add to Cart AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL) sgRNA (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donor Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Add to Cart CRISPRa library sgRNA, puro-T2A-BFP Mammalian Expression, Lentiviral, CRISPR Weissman Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. Add to Cart gRNA_DNMT3a-T1 gRNA_DNMT3a-T1 (Homo sapiens) Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart gRNA_DNMT3a-T2 gRNA_DNMT3a-T2 (Homo sapiens) Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart gRNA_DNMT3b gRNA_DNMT3b (Homo sapiens) Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Add to Cart lentiCRISPR - EGFP sgRNA 2 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 2 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart pAc-y1sgRNA-Cas9 Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster), y1 sgRNA (Drosophila melanogaster) Insect Expression, CRISPR Liu Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120. Add to Cart pCRISPR::rpsL CRISPR::rpsL CRISPR ; E.coli Marraffini RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. Add to Cart pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA) Cas9 (Synthetic), ttTi5605 sgRNA (Other) Worm Expression, CRISPR Goldstein Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. Add to Cart pJA58 dpy-10(cn64) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJW1285 sgRNA(F+E) targeting pha-1 (Synthetic) Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361. Add to Cart pLKO.1-puro U6 sgRNA CAG negative control sgRNA (Other) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pSLQ1661-sgMUC4-E3(F+E) optimized sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System.Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Add to Cart pT7EGFPgRNA egfp target (Synthetic) CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl Acad Sci U S A. 2013 Aug 5. Add to Cart pT7tyrgRNA tyr gRNA (Danio rerio) CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl Acad Sci U S A. 2013 Aug 5. Add to Cart pU6-sgCXCR4-2 sgCXCR4 -2 (Homo sapiens), Puromycin resistance and mCherry Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart PU6::klp-12_sgRNA klp-12 targeting sgRNA (Synthetic) Worm Expression, CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. Add to Cart pX330A-1x2 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-2 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR sgRNA, Cre recombinase Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Add to Cart AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR sgRNA, Renilla luciferase, Cre recombinase Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Add to Cart AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR sgRNA, Cre recombinase, EGFP Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Add to Cart AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR sgRNA, Cre recombinase Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Add to Cart CMVp-dsRed2-Triplex-28-gRNA1-28-pA dsRed2 (Homo sapiens) Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Add to Cart CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA dsRed2 (Homo sapiens) Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Add to Cart CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA dsRed2 (Homo sapiens) Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Add to Cart CRISPRi library sgRNA, puro-T2A-BFP Mammalian Expression, Lentiviral, CRISPR Weissman Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. Add to Cart DR274-eGFP sgRNA EGFP sgRNA (Synthetic) CRISPR Del Bene Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. Add to Cart EE-SP!gIII Cas9 (Other), anti-gIII tracrRNA (Synthetic) CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Add to Cart gRNA-eGFP-Reporter gRNA (5'-AAAGGTCGAGAAACTGCAAA-3') Mammalian Expression, CRISPR Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Add to Cart gRNA-hIRF-1 #12 gRNA_hIRF1 promoter #12 (Homo sapiens) Mammalian Expression, CRISPR Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR.Biochem Biophys Res Commun. 2013 Aug 11. pii: S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013. Add to Cart gRNA-hIRF-1 #12/pSIR gRNA_hIRF1 promoter #12 (Homo sapiens) Mammalian Expression, Retroviral, CRISPR Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Add to Cart gRNA-his-HYB gBlock product of his3 deletion gRNA cassette (Synthetic) Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. Add to Cart gRNA-leu-HYB gBlock product of leu2 deletion gRNA cassette (Synthetic) Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. Add to Cart gRNA-trp-HYB gBlock product of trp1 deletion gRNA cassette (Synthetic) Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. Add to Cart gRNA-ura-HYB gBlock product of ura3 deletion gRNA cassette (Synthetic) Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. Add to Cart Human BLIMP1 sgRNA hBLIMP1 sgRNA (Homo sapiens) Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Add to Cart Human SOX17 sgRNA hSox17 sgRNA (Homo sapiens) Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Add to Cart Human T (BRACHYURY) sgRNA hT sgRNA (Homo sapiens) Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Add to Cart lentiCRISPR - EGFP sgRNA 3 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 3 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart lentiCRISPR - EGFP sgRNA 4 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 4 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart lentiCRISPR - EGFP sgRNA 5 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 5 (Synthetic) Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart lentiCRISPR - EGFP sgRNA 6 Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 6 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Add to Cart M-SP-sgRNA sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter (Synthetic) CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Add to Cart MLM3636-Prnp-CDS-Neg PrP guiding sequence (Mus musculus) Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. Add to Cart MLM3636-Prnp-CDS-Pos PrP guiding sequence (Mus musculus) Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. Add to Cart pAdSh.U6.gRNAGFP U6.gRNAGFP cassette (Synthetic) Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. Add to Cart pAdSh.U6.gRNAS1 U6.gRNAS1 cassette (Synthetic) Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. Add to Cart pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1 sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic) Plant Expression, CRISPR Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39. Add to Cart pAN-AND A1NT sgRNA (Synthetic), A4NT sgRNA (Synthetic), A2NT sgRNA (Synthetic), A1NT (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-NOR A2NT sgRNA (Synthetic), A2NT sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-OR-MalT-3NT A2NT sgRNA (Synthetic), Malt-3NT sgRNA (Synthetic), A2NT sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A1NT A1NT (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A1T A1T sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A2NT A2NT sgRNA Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A2T A2T sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A3NT A3NT sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A3T A3T sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A4NT A4NT sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A4T A4T sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A5NT A5NT sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-A5T A5T sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-scramble scramble sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pAN-PBAD-sgRNA-VR VR sgRNA (Synthetic) Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. Add to Cart pCAS S. pyogenese Cas9 (Other), RNA pol III promoter (tRNA-Tyr) (Saccharomyces cerevisiae), hepatitis delta virus ribozyme, genomic (Other), sgRNA (Synthetic) Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology Cate Selection of chromosomal DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703. Add to Cart pCas cas9 (Other) Bacterial Expression, CRISPR ; Lambda Red recombinase Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. Add to Cart pCCM935 unc-22 sgRNA (Caenorhabditis elegans) Worm Expression Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30. pii: genetics.114.166389. Add to Cart pCCM936 avr-14 sgRNA (Caenorhabditis elegans) Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30. pii: genetics.114.166389. Add to Cart pCCM937 avr-15 sgRNA (Caenorhabditis elegans) Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30. pii: genetics.114.166389. Add to Cart pDR348 FANCF gRNA-FANCF (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pDR366 RNF2 gRNA-RNF2 (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pFYF1320 EGFP Site#1 gRNA-EGFP site 1 (Synthetic) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pFYF1327 EGFP Site#2 gRNA-EGFP site 2 (Synthetic) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pFYF1328 EGFP Site#3 gRNA-EGFP site 3 (Synthetic) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pFYF1548 EMX1 gRNA-EMX1 (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pJA14 rde-1(H974) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA42 rol-6(su1006) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA45 rde-1(D718) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA46 rde-1(D801) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA50 unc-58(e665) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA54 sqt-1(e1350) gRNA1 (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA55 sqt-1(e1350) gRNA2 (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJA59 unc-109(n499) gRNA (Caenorhabditis elegans) CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730. Add to Cart pJW1219 sgRNA(F+E) (Synthetic) Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361. Add to Cart pJZC101 sgRNA, COM-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC102 sgRNA Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC103 sgRNA Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC116 sgRNA + 2x MS2 (wt+f6) binding module, MCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC25 sgRNA + 1x MS2 binding module, MCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC32 sgRNA, MCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC33 sgRNA + 2x MS2 binding module, MCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC34 sgRNA + 2x MS2(wt+f6) binding module, MCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC35 sgRNA Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC39 sgRNA + 1x PP7, mCherry Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC40 sgRNA + 2x PP7, mCherry Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC41 sgRNA, PCP-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC48 sgRNA + 1x COM binding module, COM-VP64 Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC523 sgRNA Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC545 sgRNA + 1x MS2 binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC548 sgRNA + 1x PP7 Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC572 sgRNA + 1x com RNA binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC583 sgRNA + 2x MS2 binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC588 sgRNA + 2x MS2 (wt+f6) binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC593 sgRNA + MS2-PP7 RNA binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC603 sgRNA + 2x PP7 RNA binding module Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC625 sgRNA +1x MS2, Pol II promoter with ribozyme cleavage Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC73 sgRNA, COM-KRAB Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC74 sgRNA + 1x COM binding module, COM-KRAB Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC77 sgRNA, COM-KRAB Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pJZC78 sgRNA + 1x COM binding module, COM-KRAB Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. Add to Cart pLH-nmsgRNA1.1 Nm sgRNA1.1 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Pederson Multicolor CRISPR labeling of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Add to Cart pLH-spsgRNA2 Sp sgRNA2 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Pederson Multicolor CRISPR labeling of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Add to Cart pLH-stsgRNA1.1 St1 sgRNA1.1 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Pederson Multicolor CRISPR labeling of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Add to Cart pLH-stsgRNA2.1 St1 sgRNA2.1 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Pederson Multicolor CRISPR labeling of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Add to Cart pLH-stsgRNA3.1 St1 sgRNA3.1 (Synthetic) Mammalian Expression, Lentiviral, CRISPR Pederson Multicolor CRISPR labeling of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Add to Cart pLKO.1-puro U6 sgRNA Oct4A -12 Oct4A -12 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLKO.1-puro U6 sgRNA Oct4A -158 Oct4A -158 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLKO.1-puro U6 sgRNA SOX17 -126 Sox17 -126 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLKO.1-puro U6 sgRNA SOX17 -177 Sox17 -177 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLKO.1-puro U6 sgRNA SOX17 -296 Sox17-296 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLKO.1-puro U6 sgRNA SOX17 -91 Sox17 -91 sgRNA (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Add to Cart pLV-sgCDKN1B#2 BFP BFP Mammalian Expression, Lentiviral, CRISPR Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039. Add to Cart PM-SP!TA Bacterial SP crRNA to prototspacer A (Synthetic) CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Add to Cart PM-SP!TB Bacterial SP crRNA to prototspacer B (Synthetic) CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Add to Cart pMM178 Cas9, tracrRNA, crRNA (Other) Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Add to Cart pMM441 Cas9, tracrRNA, crRNA (Other) Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Add to Cart pMZ284 rrk1-sgRNA (Schizosaccharomyces pombe) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pMZ285 rrk1-sgRNA (Schizosaccharomyces pombe) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pMZ286 rrk1-sgRNA (Schizosaccharomyces pombe) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pMZ288 Cas9 (Other), rrk1:sgRNA (Other) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pMZ289 Cas9 (Other), rrk1:sgRNA (Other) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pMZ381 Cas9 (Other), rrk1:sgRNA (Other) Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Add to Cart pRC319 Cas9, tracrRNA, crRNA (Other) Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Add to Cart pRPR1_a1gRNA_RPR1t a1 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c1gRNA_RPR1t c1 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c2gRNA_RPR1t c2 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c3gRNA_RPR1t c3 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c5gRNA_RPR1t c5 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c6gRNA_RPR1t c6 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c7gRNA_RPR1t c7 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_c8gRNA_RPR1t c8 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRPR1_g1gRNA_RPR1t g1 gRNA (Saccharomyces cerevisiae) Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. Add to Cart pRS316-RGR-GFP RGR-GFP (Synthetic) Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Add to Cart pRS316-RGR-GFP-mHDV RGR-GFP (Synthetic) Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Add to Cart pRS316-RGR-GFP-mHH RGR-GFP (Synthetic) Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Add to Cart pRS316-RGR-GFP-mm RGR-GFP (Synthetic) Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Add to Cart pSAG1::CAS9-U6::sg290860-6 CRISPR sg290860-6 CRISPR ; ; Toxoplasma gondii Sibley Genetic mapping reveals that sinefungin resistance in Toxoplasma gondii is controlled by a putative amino acid transporter locus that can be used as a negative selectable marker. Eukaryot Cell. 2014 Dec 5. pii: EC.00229-14. Add to Cart pSNR52-sgTEF1 sgTEF1 promoter (Saccharomyces cerevisiae) Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pSNR52-sgTET sgTEF1 (Saccharomyces cerevisiae) Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pT7-gRNA:Asip Agouti signaling protein gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7-gRNA:kit-1 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7-gRNA:kit-2-1 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7-gRNA:kit-2-2 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7-gRNA:Tyr (albino) Tyrosinase gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7-gRNA:Tyr (wild) Tyrosinase gRNA (Rattus norvegicus) CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Add to Cart pT7ddx19gRNA ddx19 gRNA (Danio rerio) CRISPR Wente Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl Acad Sci U S A. 2013 Aug 5. Add to Cart pT7goldRNA golden gRNA (Danio rerio) CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl Acad Sci U S A. 2013 Aug 5. Add to Cart pT7mitfagRNA mitfa gRNA (Danio rerio) CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl Acad Sci U S A. 2013 Aug 5. Add to Cart pTargetF sgRNA (Synthetic) Bacterial Expression, CRISPR Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. Add to Cart pU6-sgCD71-2 sgCD71 -2 (Homo sapiens), Puromycin resistance and mCherry Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pU6-sgGAL4-1 sgGAL4-1, Puromycin resistance and mCherry Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pU6-sgGAL4-4 sgGAL4-4, Puromycin resistance and mCherry Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Add to Cart pU6a:sgRNA(tyr) U6a:sgRNA (tyr) (Danio rerio) CRISPR Chen Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917. Add to Cart pVC228 VEGF Site#3 gRNA-VEGF site 3 (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pVC297 VEGF Site#1 gRNA-VEGF site 1 (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pVC299 VEGF Site#2 gRNA-VEGF site 2 (Homo sapiens) Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. Add to Cart pX330 Ctnnb1.1 Ctnnb1 (Mus musculus) Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. Add to Cart pX330 Ctnnb1.2 Ctnnb1 (Mus musculus) Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. Add to Cart pX330 p53 p53 (Mus musculus) Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. Add to Cart pX330 Pten Pten (Mus musculus) Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. Add to Cart px330-gp78 gp78 (Homo sapiens) CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. Add to Cart px330-USP13 USP13 (Homo sapiens) CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. Add to Cart pX330A-1x3 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A-1x4 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A-1x5 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A-1x6 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A-1x7 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x2 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x3 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x4 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x5 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x6 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330A_D10A-1x7 humanized S. pyogenes Cas9 (D10A) nickase (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-3 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-4 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-5 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-6 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart pX330S-7 humanized S. pyogenes Cas9 nuclease (Other) Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Add to Cart px335 Mettl14 sgRNA #1 gcggcagctcctagctcagc (Mus musculus) Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 Add to Cart px335 Mettl14 sgRNA #2 gccgctcccggatctcctgc (Mus musculus) Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 Add to Cart RFN_EGFP_47 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart RFN_EGFP_80 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart RFN_EGFP_81 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart RFN_EGFP_82 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart RFN_EGFP_83 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart RFN_EGFP_84 pair of multiplex gRNAs targeting EGFP Mammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Add to Cart sgRNA1_ASCL1 sgRNA1_ASCL1 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA1_GAL4UAS-Luciferase reporter sgRNA1 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA1_IL1RN IL1RN (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA1_MYOD1 sgRNA1_MYOD1 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA1_NANOG sgRNA1_NANOG (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA2_ASCL1 sgRNA1_ASCL2 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA2_GAL4UAS-Luciferase reporter sgRNA2 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA2_IL1RN sgRNA2_IL1RN (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA2_MYOD1 sgRNA1_MYOD1 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA2_NANOG sgRNA2_NANOG (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA3_ASCL1 sgRNA1_ASCL3 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA3_GAL4UAS-Luciferase reporter sgRNA3 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA3_IL1RN sgRNA3_IL1RN (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA3_MYOD1 sgRNA1_MYOD1 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA3_NANOG sgRNA3_NANOG (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA4_ASCL1 sgRNA1_ASCL4 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA4_IL1RN sgRNA4_IL1RN (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA4_MYOD1 sgRNA1_MYOD1 (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart sgRNA4_NANOG sgRNA4_NANOG (Homo sapiens) Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Add to Cart U6>Control(F+E) Control (F+E) sgRNA CRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Add to Cart U6>Ebf.774(F+E) Ebf.774 (F+E) sgRNA CRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Add to Cart Zebrafish-gRNA-0001 gRNA-apoea (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0002 gRNA-drd3 (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0003 gRNA-fh site #1 (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0004 gRNA-fh site #2 (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0005 gRNA-gsk3b (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0006 gRNA-rgs4 (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0007 gRNA-th1 (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0008 gRNA-tia1l (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Zebrafish-gRNA-0009 gRNA-tph1a (Danio rerio) CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. Add to Cart Empty gRNA Vectors Select a gRNA expression plasmid based on factors such as selectable marker or cloning method. When using the CRISPR/Cas system, you will need to express both a Cas9 protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas9 act as an all-in-one vector, but their function (cut, nick, activate, interfere...) is limited to that of the Cas9 present on the plasmid. gRNA plasmids that do not co-express Cas9 require a separate plasmid that does so; however, these independent gRNA plasmids can be paired with a wide variety of Cas9 plasmids and therefore are not limited to a single Cas9 function. Mammalian gRNA Plasmid Promoter Cloning Delivery Selection Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) gRNA_Cloning Vector hU6 AfIII Transfection Bleocin none, need Cas9 plasmid Church pSPgRNA hU6 BbsI Transfection none, need Cas9 plasmid Gersbach phH1-gRNA human H1 BbsI Transfection none, need Cas9 plasmid Gersbach pmU6-gRNA mouse U6 BbsI Transfection none, need Cas9 plasmid Gersbach phU6-gRNA human U6 BbsI Transfection none, need Cas9 plasmid Gersbach ph7SK-gRNA human 7SK BbsI Transfection none, need Cas9 plasmid Gersbach pGL3-U6-sgRNA-PGK-puromycin hU6 Transfection Puromycin none, need Cas9 plasmid Huang pUC57-sgRNA expression vector T7 BsaI In vitro transcription none, need Cas9 plasmid Huang pAC155-pCR8-sgExpression hU6 BbsI Transfection none, need Cas9 plasmid Jaenisch pAC154-dual-dCas9VP160-sgExpression hU6 BbsI Transfection yes, activate Jaenisch pAC153-dual-dCas9VP96-sgExpression hU6 BbsI Transfection yes, activate Jaenisch pAC152-dual-dCas9VP64-sgExpression hU6 BbsI Transfection yes, activate Jaenisch pAC5-dual-dCas9VP48-sgTetO hU6 BbsI Transfection yes, activate Jaenisch pAC2-dual-dCas9VP48-sgExpression hU6 BbsI Transfection yes, activate Jaenisch MLM3636 hU6 BsmBI Transfection none, need Cas9 plasmid Joung pSQT1313 hU6 BsmBI Transfection none, need Cas9 plasmid Joung pU6_gRNA_handle_U6t U6 SacI Transfection EBFP none, need Cas9 plasmid Lu pgRNA-humanized mU6 BstXI + XhoI Lentiviral Puromycin, none, need Cas9 plasmid Qi mCherry pLX-sgRNA hU6 See paper Lentiviral Blasticidin none, need Cas9 plasmid Sabatini and Lander pLenti-sgRNA-Lib hU6 BsmBI Lentiviral ccdB none, need Cas9 plasmid Wei pLKO.1-puro U6 sgRNA BfuAI stuffer hU6 BfuAI Lentiviral Puromycin none, need Cas9 plasmid Wolfe pLKO.1-puro U6 sgRNA BfuAI large stuffer hU6 BfuAI Lentiviral Puromycin none, need Cas9 plasmid Wolfe pKLV-U6gRNA(BbsI)-PGKpuro2ABFP hU6 BbsI Lentiviral Puromycin, none, need Cas9 plasmid Yusa TagBFP lentiGuide-Puro hU6 BsmBI Lentiviral Puromycin none, need Cas9 plasmid Zhang lentiCRISPR v2 hU6 BsmBI Lentiviral Puromycin yes, cut Zhang PX462 (3rd Gen) hU6 BbsI Transfection Puromycin yes, nick (D10A) Zhang PX461 (3rd Gen) hU6 BbsI Transfection EGFP yes, nick (D10A) Zhang PX460 (3rd Gen) hU6 BbsI Transfection yes, nick (D10A) Zhang PX459 (3rd Gen) hU6 BbsI Transfection Puromycin yes, cut Zhang PX458 (3rd Gen) hU6 BbsI Transfection EGFP yes, cut Zhang PX335 (2nd Gen) hU6 BbsI Transfection yes, nick (D10A) Zhang PX334 (1st Gen) hU6 BbsI Transfection Puromycin yes, nick (D10A) Zhang PX330 (2nd Gen) hU6 BbsI Transfection yes, cut Zhang PX260 (1st Gen) hU6 BbsI Transfection Puromycin yes, cut Zhang Cas9 species = N. meningitidis (PAM = NNNNGATT) pSmart-Nm-sgRNA-BbsI hU6 BbsI Transfection none, need Cas9 plasmid Thomson and Sontheimer pSimpleII-U6-tracr- hU6 BsmBI Transfection yes, cut Thomson and U6-BsmBI-NLS- Sontheimer NmCas9-HA-NLS(s) Bacteria gRNA Plasmid Promoter Cloning Validated In Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pCRISPR BsaI E. coli, Chloramphenicol none, need Cas9 plasmid Marraffini S. pneumoniae pCas9 BsaI E. coli, Chloramphenicol yes, cut Marraffini S. pneumoniae pgRNA-bacteria BBa_J23119 SpeI + HindIII Ampicillin none, need Cas9 plasmid Qi Drosophila gRNA Plasmid Promoter Cloning Delivery Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port pCFD2-dU6:2gRNA dU6:2 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port pRB17 U6 blunt end cloning Injection or in vitro transcription none, need Cas9 plasmid Foerstemann pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu U6-BbsI-crRNA dU6 BbsI Transfection none, need Cas9 plasmid O'Connor-Giles, Harrison, Wildonger pU6-BbsI-chiRNA dU6 BbsI Transfection none, need Cas9 plasmid O'Connor-Giles, Harrison, Wildonger C. elegans gRNA Plasmid Promoter Cloning Delivery Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) sgRNA with U6 promoter cU6 HindIII Injection none, need Cas9 plasmid de Bono sgRNA with rpr-1 promoter rpr-1 EcoRI Injection none, need Cas9 plasmid de Bono pMB70 cU6 BsaI Transfection none, need Cas9 plasmid Boxem pMB60 T7 BsaI In vitro transcription none, need Cas9 plasmid Boxem PU6::klp-12_sgRNA cU6 PCR (see paper) Transfection none, need Cas9 plasmid Calarco pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid Joung SP6-sgRNA-scaffold SP6 AflII In vitro transcription none, need Cas9 plasmid Sternberg Plant gRNA Plasmid Promoter Cloning Validated In Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pICSL01009::AtU6p aU6 BsaI Arabidopsis none, need Cas9 plasmid Kamoun pFGC-pcoCas9 none AscI, PacI, SbfI Arabidopsis yes, cut Sheen pUC119-gRNA U6 PCR template Arabidopsis none, need Cas9 plasmid Sheen pRGEB31 rice snoRNA U3 BsaI Arabidopsis none, need Cas9 plasmid Yang pRGE31 rice snoRNA U3 BsaI Arabidopsis none, need Cas9 plasmid Yang Yeast gRNA Plasmid Promoter Cloning Validated In Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pRPR1_gRNA_ pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu handle_RPR1t Zebrafish gRNA Plasmid Promoter Cloning Delivery Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pT7-gRNA T7 BsmBI In vitro transcription none, need Cas9 plasmid Chen and Wente DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid Joung Xenopus gRNA Plasmid Promoter Cloning Delivery Resistance Co-expressed Cas9 Depositing lab Enzyme(s) Cas9 species = S. pyogenes (PAM = NGG) pUC57-Simple-gRNA backbone T7 BsaI In vitrotranscription none, need Cas9 plasmid Chen 
