首页 » CRISPR/Cas9系统质粒载体列表2-BioVector NTCC保藏中心

CRISPR/Cas9系统质粒载体列表2-BioVector NTCC保藏中心

  • 价  格:¥2930
  • 货  号:CRISPR/Cas9 plasmids 2
  • 产  地:北京
点击询问我要采购
 竭诚为您服务!
BioVector NTCC典型培养物保藏中心
联系人:Dr.Xu, Biovector NTCC Inc.

电话:400-800-2947 工作QQ:1843439339 (微信同号)

邮件:Biovector@163.com

手机:18901268599

地址:北京

已注册
 


Plant






Showing 1 to 2 of 2  entries





records per  page





Search table:





Previous













Next






PlasmidGene/InsertPromoterSelectable  MarkerPIPublication









pBUN6A11dCas9-VP64 (Synthetic),  gRNA scaffold (Synthetic)Ubi1p, OsU3pBarChenA CRISPR/Cas9 toolkit for  multiplex genome editing in plants. BMC Plant Biol. 2014 Nov  29;14(1):327.Add to Cart

pHSN6A01dCas9-VP64  (Synthetic), gRNA scaffold (Synthetic)2×35Sp,  AtU6-26pHygromycinChenA CRISPR/Cas9 toolkit for  multiplex genome editing in plants. BMC Plant Biol. 2014 Nov  29;14(1):327.Add to Cart
dCas9-FokI












Showing 1 to 2 of 2 entries





records per page





Search table:







Previous













Next






IDPlasmidGene/InsertVector TypePromoterPIPublication      









52970FokI-dCas9Fok1 fused to dCas9  (Other)Mammalian Expression,  CRISPRCMVLiuFusion of catalytically  inactive Cas9 to FokI nuclease improves the specificity of genome  modification. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2909.

53369pSQT1601hCsy4-T2A-NLS-hFokI-dCas9-NLSMammalian  Expression, CRISPRCAGJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.
Drosophila

















Search table:





Previous













Next






 ID  Plasmid  Gene/Insert  Vector Type  Promoter  PI  Publication









62210pnos-Fok1:dCas9-nosFok1-dCas9Insect  ExpressionnanosBullockCRISPRflydesign(unpublished)

62211pAct-Fok1:dCas9Fok1-dCas9Insect  Expressionact5CBullockCRISPRflydesign(unpublished)
Purify












Showing 1 to 5 of 5 entries





records per page





Search table:





Previous













Next






PlasmidGene/InsertVector TypePromoterSelectable  MarkerPIPublication









3xFLAG-dCas9/pCMV-7.13xFLAG-dCas9Mammalian Expression,  CRISPRCMV
FujiiEfficient isolation of  specific genomic regions and identification of associated proteins by  engineered DNA-binding molecule-mediated chromatin immunoprecipitation  (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Aug 11. pii:  S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013.

3xFLAG-dCas9/pMXs-neo3xFLAG-dCas9  (Synthetic)Mammalian  Expression, Retroviral, CRISPRLTRNeomycinFujiiIdentification of Proteins  Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression  System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi:  10.1371/journal.pone.0103084. eCollection 2014.

3xFLAG-dCas9/pMXs-puro3xFLAG-dCas9  (Synthetic)Mammalian  Expression, Retroviral, CRISPRLTRPuromycinFujiiIdentification of Proteins  Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression  System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi:  10.1371/journal.pone.0103084. eCollection 2014.

3xFLAG-dCas9/pMXs-I23xFLAG-dCas9  (Synthetic)Mammalian  Expression, Retroviral, CRISPRLTRhuman CD2FujiiIdentification of Proteins  Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression  System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi:  10.1371/journal.pone.0103084. eCollection 2014.

3xFLAG-dCas9/pMXs-IG3xFLAG-dCas9  (Synthetic)Mammalian  Expression, Retroviral, CRISPRLTRenhanced  GFPFujiiIdentification of Proteins  Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression  System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi:  10.1371/journal.pone.0103084. eCollection 2014.








Yeast





Showing 1 to 1 of 1 entries





records per page





Search table:





Previous













Next






PlasmidGene/InsertVector TypePromoterSelectable MarkerPIPublication









3xFLAG-dCas9/pTEF1p-CYC1t3xFLAG-dCas9 (Synthetic)Yeast Expression, CRISPRTEF1 promoterTRP1FujiiEfficient isolation of  specific genomic regions and identification of associated proteins by  engineered DNA-binding molecule-mediated chromatin immunoprecipitation  (enChIP) using CRISPR.Biochem Biophys Res Commun. 2013 Aug 11. pii:  S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013.
Visualize






A  catalytically inactive Cas9 (dCas9) fused to a fluorescent protein (FP) can  be used to visualize specific genomic loci using fluorescent microscopy in  living cells. Design your gRNA sequence to direct the dCas9-FP fusion to a  specific genomic sequence. Potential target locations can include unique or  repetitive regions. If the plasmid that you choose does not also express a  gRNA, you will need to use a separate gRNA expression plasmid to target the  dCas9-FP protein.
Mammalian





Showing 1 to 13 of 13 entries




records per page





Search table:





Previous













Next






PlasmidGene/InsertVector TypePromoterSelectable MarkerPIPublication









pHR-SFFV-dCas9-BFPdCas9-BFP fusion (Homo  sapiens)Mammalian Expression,  Lentiviral, CRISPRSFFV
WeissmanCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.

pSLQ1658-dCas9-EGFPdCas9 fuse  to EGFP (Homo sapiens)Mammalian  Expression, Retroviral, CRISPRMSCV LTR  promoterPuromycinQiDynamic Imaging of Genomic  Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013  Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.

pHAGE-EFS-dCas9-GFPSp dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPREFS
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-SSFV-dCas9-GFPSp dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRSSFV
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-dCas9-3XGFPSp dCas9  (Synthetic)Mammalian  Expression, LentiviralCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-dCas9-3XmCherrySp dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-dCas9-GFPSp dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nls-st1dCas9-3nls-3XGFPSt1 dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nls-st1dCas9-3nls-3XGFP-2nlsSt1 dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nls-st1dCas9-3nls-3XGFP-nlsSt1 dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2St1 dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nmdCas9-3XGFPNm dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

pHAGE-TO-nmdCas9-3XmCherryNm dCas9  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRCMV-TO
PedersonMulticolor CRISPR labeling  of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.
Screen (libraries)






The  CRISPR/Cas9 system has quickly become an important tool for the genome  engineering community, but the technique has primarily been limited to  focused gene knock-outs and direct transfection protocols. The vectors and  sgRNA libraries described below expand upon the CRISPR family of plasmids by  A) offering a lentivirus-based mechanism for sgRNA delivery and B) providing  a means for large scale functional screens.

   Before ordering, please review the steps for using pooled lentiviral CRISPR  libraries and keep the following in mind:

   These libraries are pooled. Most of these screens that can be done with the  libraries will require access to next generation sequencing technology.
   These libraries are lentiviral in nature, so please ensure that you are  equipped and authorized to make and use lentivirus. Also, note that due to  the size of the backbone, transformations require electroporation.

   Jonathan Weissman Lab (targets human genes)

   The libraries described in the following article use inactive dCas9 to  activate (CRISPRa) or inhibit (CRISPRi) gene transcription in human cells.  The CRISPRa sgRNA library uses the sunCas9 system and contains 10 sgRNAs for  each transcription start site in 15,977 human genes, and a set of 5,968  control sgRNAs for a total of 198,810 sgRNAs. The CRISPRi library contains 10  sgRNAs for each transcription start site in 15,977 human genes, and a set of  11,219 control sgRNAs for a total of 206,421 sgRNAs.

   The parental vector for the CRISPRa and CRISPRi libraries is pU6-sgRNA  EF1Alpha-puro-T2A-BFP. Plasmids pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP and  pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS comprised the dCas9-SunTag and  scFV-VP64 components of the CRISPRa system, as described in the associated  publication. Plasmid pHR-SFFV-dCas9-BFP-KRAB was used for stable expression  of the dCas9-KRAB fusion protein for CRISPRi.

   Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.  Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH,  Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS.  Cell. 2014 Oct 8. PubMed.
TypeIDItem




Library60956CRISPRa LibraryAdd to Cart



Library62217CRISPRi LibraryAdd to Cart



Plasmid60955pU6-sgRNA EF1Alpha-puro-T2A-BFP:  Lentiviral expression of an sgRNA sequence, with co-expression of puromycin  and BFP for selection. Parental vector for CRISPRa and CRISPRi libraries.Add to Cart



Plasmid60903pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP:  Lentiviral expression of dCas9 fused to 10 GCN4 peptides, co-expressing BFP.  A component of the SunTag system used in CRISPRa experiments.Add to Cart



Plasmid60904pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS:  Lentiviral expression of a single-chain variable fragment (scFv) antibody  fused to VP64 that binds GCN4 peptides in the SunTag system. Co-expresses  GFP. Used in CRISPRa experiments.Add to Cart



Plasmid46911pHR-SFFV-dCas9-BFP-KRAB: Lentiviral  expression of a dCas9-BFP-KRAB fusion protein, used for stable expression in  CRISPRi experiments.Add to Cart



Feng Zhang Lab (libraries targeting human and mouse  genes)


SAM library





The  synergistic activation mediators (SAM) library is now available.


CRISPR/Cas9 Synergistic Activation Mediator (SAM) is an  engineered protein complex for the transcriptional activation of endogenous  genes. The SAM library consists of 3 unique sgRNAs targeting each human  RefSeq coding isoform in the proximal promoter (> 90% of sgRNAs are  targeted to the first 200bp upstream of the transcription start site of their  target). The total library size is 70,290 guides. For SAM gain-of-function  screening, this sgRNA library has to be combined with two additional SAM  constructs – dCas9-VP64 and MS2-P65-HSF1.
These are provided along with the library.




Genome-scale  transcriptional activation by an engineered CRISPR-Cas9  complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO,  Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O & Zhang  F. Nature doi:10.1038/nature14136 (2014)PubMed
TypeIDItem




Plasmid61425dCas9-VP64 plasmid page: A  nucleolytically inactive Cas9-VP64 fusionIncluded



Plasmid61426MS2-P65-HSF1 plasmid page: Expresses the  activation helper proteinIncluded



Library
Human SAM Library, 3  plasmid systemOrder Here



GeCKO v2 library





The human genome-scale CRISPR-Cas9 knockout (GeCKO) v2  library consists of 122,417 unique guide sequences targeting 19,052 human  genes and including 1000 control (non-targeting) sgRNAs. The murine library  consists of 130,209 unique guide sequences targeting 20,661 murine genes.  There are two versions of each library. The lentiCRISPR v2 still expresses  both Cas9 and the sgRNA on the same plasmid but can produce 10-fold higher  titers than the original lentiCRISPR backbone. The 2 vector format uses  lentiGuide-Puro as a backbone and produces an even higher titer but must be  used with cells that already contain Cas9. The lentiCas9-Blast vector is  provided with this 2-plasmid version of the GeCKO library.
TypeIDItem




Plasmid52961lentiCRISPR v2: Lentiviral expression of  hSpCas9 and sgRNA (replaces Addgene plasmid 49535)Backbone  for 1 plasmid system



Plasmid52962lentiCas9-Blast: Lentiviral expression  of human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance  from EFS promoter.Ships  with 2 plasmid system



Plasmid52963lentiGuide-Puro: Lentiviral expression  of S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6  promoter and puromycin resistance from EF-1a promoter.Backbone  for 2 plasmid system



Library
Human GeCKO v2  Library, 1 plasmid systemOrder Here



Library
Human GeCKO v2  Library, 2 plasmid systemOrder Here



Library
Mouse GeCKO v2  Library, 1 plasmid systemOrder Here



Library
Mouse GeCKO v2  Library, 2 plasmid systemOrder Here



David Sabatini Lab / Eric Lander Lab (targets human  genes)


The library described in this article consists of 73,151  sgRNA plasmids that cover a total of 7,114 human genes and include 100  non-targeting controls. The library has been separated into 6 distinct  enriched sub-pools: 4 pools enriched for gene targets of known function  (kinases, cell cycle proteins, nuclear proteins, and ribosomal proteins), 1  pool that targets genes of unknown function, and 1 control pool. Note that  though each sub-pool is enriched for their respective target sgRNAs, they are  not exclusive and elements of the entire library may be present in each  sub-pool.
There are two lentiviral vectors associated with this  paper, one expressing Cas9 (pCW-Cas9) and the sgRNA backbone (pLX-sgRNA).
Genetic  Screens in Human Cells Using the CRISPR/Cas9 System. Wang T, Wei JJ,  Sabatini DM, Lander ES. Science. 2013 Dec 12.PubMed.
TypeIDItem




Plasmid50661pCW-Cas9: Inducible lentiviral  expression of SpCas9.Add to Cart



Plasmid50662pLX-sgRNA: Lentiviral expression of  AAVS1-targeting sgRNA which can be replaced with custom sgRNA.Add to Cart



Library51043Human Lentiviral sgRNA Library -  Enriched Against Proteins of Unknown FunctionAdd to Cart



Library51044Human Lentiviral sgRNA Library -  Enriched Against KinasesAdd to Cart



Library51045Human Lentiviral sgRNA Library -  Enriched Against Ribosomal ProteinsAdd to Cart



Library51046Human Lentiviral sgRNA Library -  Enriched Against Cell Cycle ProteinsAdd to Cart



Library51047Human Lentiviral sgRNA Library -  Enriched Against Nuclear ProteinsAdd to Cart



Library51048Human Lentiviral sgRNA Library -  Enriched Against Control Proteins (most diverse pool)Add to Cart



Kosuke Yusa Lab (targets mouse genes)



The library described in this article consists of 87,897  unique gRNA plasmids, targeting 19,150 mouse protein coding regions. The  library is designed for lentiviral expression in mouse cells.
Genome-wide  Recessive Genetic Screening in Mammalian Cells with a Lentiviral CRISPR-guide  RNA Library. Koike-Yusa H, Li Y, Tan E-P, Del  Castillo Velasco-Herrera M, Yusa K. Nat  Bioetchnology. 2013 doi:10.1038/nbt.2800. PubMed. Nat Biotech.
TypeIDItem




Plasmid50946pKLV-U6gRNA(BbsI)-PGKpuro2ABFP :  empty gRNA expression vector for lentiviral production.Add to Cart



Library50947Genome-wide mouse lentiviral CRISPR gRNA  libraryAdd to Cart



Feng Zhang Lab (targets human genes)



The genome-scale CRISPR-Cas9 knockout (GeCKO) library  originally described in Shalem*, Sanjana*, et al., Science 2014. The original  library is discontinued and an updated version of this library is now  available.
Genome-Scale  CRISPR-Cas9 Knockout Screening in Human Cells. Shalem O, Sanjana NE,  Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench  JG, Zhang F. Science. 2013 Dec 12. PubMed.
TypeIDItem




Plasmid49535Lentiviral expression of hSpCas9 and  sgRNA (lentiCRISPR v2 available here)Discontinued



Library51241Human GeCKO  Lentiviral sgRNA Library (Human and Mouse GeCKO v2 available here)Discontinued



Validated gRNAs






The  table below lists experimentally validated S. pyogenes gRNA plasmids designed  to target various genes or genomic regions. It is highly recommended that you  determine if your cell type contains the target sequence before using any of  these gRNA plasmids and review the publication associated with each plasmid  for more information on how it was originally used.








Validated gRNA Plasmids




Showing 1 to 240 of 240 entries




records per page





Search table:





Previous













Next






PlasmidGene/InsertVector TypePIPublication










gRNA_AAVS1-T1gRNA_AAVS1-T1Mammalian Expression,  CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

gRNA_AAVS1-T2gRNA_AAVS1-T2Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

gRNA_GFP-T1gRNA_GFP-T1Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

gRNA_GFP-T2gRNA_GFP-T2Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

p426-SNR52p-gRNA.CAN1.Y-SUP4tCAN1.y  gRNA (Saccharomyces cerevisiae)Yeast  Expression, CRISPRChurchGenome engineering in  Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids ResAdd  to Cart

pLX-sgRNAsgAAVS1Mammalian  Expression, Lentiviral, CRISPRSabatiniGenetic screens in human  cells using the CRISPR-Cas9 system.Science. 2014 Jan 3;343(6166):80-4. doi:  10.1126/science.1246981. Epub 2013 Dec 12.Add  to Cart

pSLQ1651-sgTelomere(F+E)Optimized  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRQiDynamic Imaging of Genomic  Loci in Living Human Cells by an Optimized CRISPR/Cas System.Cell. 2013 Dec  19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.Add  to Cart

PU6::unc-119_sgRNAunc-119  targeting sgRNA (Synthetic)CRISPRCalarcoHeritable genome editing  in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi:  10.1038/nmeth.2532.Add  to Cart

pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized  S. pyogenes Cas9Mammalian  Expression, CRISPRZhangMultiplex Genome  Engineering Using CRISPR/Cas Systems.Science. 2013 Jan 3.Add  to Cart

lentiCRISPR - EGFP sgRNA 1Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 1 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart

pICH86966::AtU6p::sgRNA_PDSAtU6p::sgRNA_PDS  (Synthetic)CRISPR ;  Plant expressionKamounTargeted mutagenesis in  the model plant Nicotiana benthamiana using Cas9 RNA-guided  endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi:  10.1038/nbt.2655.Add  to Cart

pU6-sgGFP-NT1sgGFP-NT1Mammalian  Expression, Lentiviral, CRISPRQiCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pUC119-gRNAguide RNA  targeting AtPDS3 (Arabidopsis thaliana)CRISPR ;  Plant expressionSheenMultiplex and homologous  recombination-mediated genome editing in Arabidopsis and Nicotiana  benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013  Aug;31(8):688-91. doi: 10.1038/nbt.2654.Add  to Cart

pX330-Cetn1/1Cetn1  sgRNA1 (Synthetic), humanized S. pyogenes Cas9 (Other)Mammalian  Expression, CRISPRIkawaGeneration of mutant mice  by pronuclear injection of circular plasmid expressing Cas9 and single guided  RNA. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355.Add  to Cart

AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR  (AAV-KPL)sgRNA  (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donorMammalian  Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRZhangCRISPR-Cas9 Knockin Mice  for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii:  S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.Add  to Cart

CRISPRa librarysgRNA,  puro-T2A-BFPMammalian  Expression, Lentiviral, CRISPRWeissmanGenome-Scale  CRISPR-Mediated Control of Gene Repression and Activation. Cell. 2014  Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9.Add  to Cart

gRNA_DNMT3a-T1gRNA_DNMT3a-T1  (Homo sapiens)Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

gRNA_DNMT3a-T2gRNA_DNMT3a-T2  (Homo sapiens)Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

gRNA_DNMT3bgRNA_DNMT3b  (Homo sapiens)Mammalian  Expression, CRISPRChurchRNA-Guided Human Genome  Engineering via Cas9. Science. 2013 Jan 3.Add  to Cart

lentiCRISPR - EGFP sgRNA 2Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 2 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart

pAc-y1sgRNA-Cas9Cas9  (Synthetic), dU6-sgRNA (Drosophila melanogaster), y1 sgRNA (Drosophila  melanogaster)Insect  Expression, CRISPRLiuMutagenesis and homologous  recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open.  2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120.Add  to Cart

pCRISPR::rpsLCRISPR::rpsLCRISPR ;  E.coliMarraffiniRNA-guided editing of  bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2508.Add  to Cart

pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)Cas9  (Synthetic), ttTi5605 sgRNA (Other)Worm  Expression, CRISPRGoldsteinEngineering the  Caenorhabditis elegans genome using Cas9-triggered homologous  recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.Add  to Cart

pJA58dpy-10(cn64)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJW1285sgRNA(F+E)  targeting pha-1 (Synthetic)Worm  Expression, CRISPRWardRapid and Precise  Engineering of the Caenorhabditis elegans Genome with Lethal Mutation  Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9.  pii: genetics.114.172361.Add  to Cart

pLKO.1-puro U6 sgRNA CAGnegative  control sgRNA (Other)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pSLQ1661-sgMUC4-E3(F+E)optimized  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRQiDynamic Imaging of Genomic  Loci in Living Human Cells by an Optimized CRISPR/Cas System.Cell. 2013 Dec  19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.Add  to Cart

pT7EGFPgRNAegfp  target (Synthetic)CRISPRChenEfficient multiplex  biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl  Acad Sci U S A. 2013 Aug 5.Add  to Cart

pT7tyrgRNAtyr gRNA  (Danio rerio)CRISPRChenEfficient multiplex  biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl  Acad Sci U S A. 2013 Aug 5.Add  to Cart

pU6-sgCXCR4-2sgCXCR4 -2  (Homo sapiens), Puromycin resistance and mCherryMammalian  Expression, Lentiviral, CRISPRQiCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

PU6::klp-12_sgRNAklp-12  targeting sgRNA (Synthetic)Worm  Expression, CRISPRCalarcoHeritable genome editing  in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi:  10.1038/nmeth.2532.Add  to Cart

pX330A-1x2humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-2humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre  recombinaseMammalian  Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRZhangCRISPR-Cas9 Knockin Mice  for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii:  S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.Add  to Cart

AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA,  Renilla luciferase, Cre recombinaseMammalian  Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, LuciferaseZhangCRISPR-Cas9 Knockin Mice  for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii:  S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.Add  to Cart

AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre  recombinase, EGFPMammalian  Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRZhangCRISPR-Cas9 Knockin Mice  for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii:  S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.Add  to Cart

AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre  recombinaseMammalian  Expression, Mouse Targeting, AAV, Cre/Lox, CRISPRZhangCRISPR-Cas9 Knockin Mice  for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii:  S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.Add  to Cart

CMVp-dsRed2-Triplex-28-gRNA1-28-pAdsRed2  (Homo sapiens)Mammalian  Expression, Synthetic BiologyLuMultiplexed and  Programmable Regulation of Gene Networks with an Integrated RNA and  CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii:  S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.Add  to Cart

CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pAdsRed2  (Homo sapiens)Mammalian  Expression, Synthetic BiologyLuMultiplexed and  Programmable Regulation of Gene Networks with an Integrated RNA and  CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii:  S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.Add  to Cart

CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pAdsRed2  (Homo sapiens)Mammalian  Expression, Synthetic BiologyLuMultiplexed and  Programmable Regulation of Gene Networks with an Integrated RNA and  CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii:  S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.Add  to Cart
CRISPRi librarysgRNA,  puro-T2A-BFPMammalian  Expression, Lentiviral, CRISPRWeissmanGenome-Scale  CRISPR-Mediated Control of Gene Repression and Activation. Cell. 2014  Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9.Add  to Cart

DR274-eGFP  sgRNAEGFP sgRNA  (Synthetic)CRISPRDel BeneHighly efficient  CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA  repair. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113.  Epub 2013 Oct 31.Add  to Cart

EE-SP!gIIICas9  (Other), anti-gIII tracrRNA (Synthetic)CRISPRChurchOrthogonal Cas9 proteins  for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29.  doi: 10.1038/nmeth.2681.Add  to Cart

gRNA-eGFP-ReportergRNA  (5'-AAAGGTCGAGAAACTGCAAA-3')Mammalian  Expression, CRISPRGersbachA light-inducible  CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem  Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753.Add  to Cart

gRNA-hIRF-1 #12gRNA_hIRF1  promoter #12 (Homo sapiens)Mammalian  Expression, CRISPRFujiiEfficient isolation of  specific genomic regions and identification of associated proteins by  engineered DNA-binding molecule-mediated chromatin immunoprecipitation  (enChIP) using CRISPR.Biochem Biophys Res Commun. 2013 Aug 11. pii:  S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013.Add  to Cart

gRNA-hIRF-1 #12/pSIR  gRNA_hIRF1 promoter #12 (Homo sapiens)  Mammalian Expression, Retroviral, CRISPRFujiiIdentification of  Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral  Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul  22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014.Add  to Cart

gRNA-his-HYBgBlock  product of his3 deletion gRNA cassette (Synthetic)Yeast  ExpressionJinConstruction of a  quadruple auxotrophic mutant of an industrial polyploid saccharomyces  cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ  Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct  3.Add  to Cart

gRNA-leu-HYBgBlock  product of leu2 deletion gRNA cassette (Synthetic)Yeast  ExpressionJinConstruction of a  quadruple auxotrophic mutant of an industrial polyploid saccharomyces  cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ  Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct  3.Add  to Cart

gRNA-trp-HYBgBlock  product of trp1 deletion gRNA cassette (Synthetic)Yeast  ExpressionJinConstruction of a  quadruple auxotrophic mutant of an industrial polyploid saccharomyces  cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ  Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct  3.Add  to Cart

gRNA-ura-HYBgBlock  product of ura3 deletion gRNA cassette (Synthetic)Yeast  ExpressionJinConstruction of a  quadruple auxotrophic mutant of an industrial polyploid saccharomyces  cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ  Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct  3.Add  to Cart

Human BLIMP1 sgRNAhBLIMP1  sgRNA (Homo sapiens)Mammalian  Expression, CRISPRHannaSOX17 Is a Critical  Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15,  2015Add  to Cart

Human SOX17 sgRNAhSox17  sgRNA (Homo sapiens)Mammalian  Expression, CRISPRHannaSOX17 Is a Critical  Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15,  2015Add  to Cart

Human T (BRACHYURY) sgRNAhT sgRNA  (Homo sapiens)Mammalian  Expression, CRISPRHannaSOX17 Is a Critical  Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15,  2015Add  to Cart

lentiCRISPR - EGFP sgRNA 3Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 3 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart

lentiCRISPR - EGFP sgRNA 4Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 4 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart
lentiCRISPR - EGFP sgRNA 5Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 5 (Synthetic)Lentiviral,  CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart

lentiCRISPR  - EGFP sgRNA 6Cas9  (Synthetic), Puromycin resistance (Other), EGFP sgRNA 6 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRZhangGenome-scale CRISPR-Cas9  knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7.  doi: 10.1126/science.1247005. Epub 2013 Dec 12.Add  to Cart

M-SP-sgRNAsgRNA  targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6  promoter (Synthetic)CRISPRChurchOrthogonal Cas9 proteins  for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29.  doi: 10.1038/nmeth.2681.Add  to Cart

MLM3636-Prnp-CDS-NegPrP  guiding sequence (Mus musculus)Mammalian  Expression, CRISPRSchmitt-UlmsCRISPR-Cas9-Based Knockout  of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec  9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.Add  to Cart

MLM3636-Prnp-CDS-PosPrP  guiding sequence (Mus musculus)Mammalian  Expression, CRISPRSchmitt-UlmsCRISPR-Cas9-Based Knockout  of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec  9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.Add  to Cart

pAdSh.U6.gRNAGFP  U6.gRNAGFP cassette (Synthetic)  Mammalian Expression, Adenoviral, CRISPRGoncalvesAdenoviral vector  delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted  mutagenesis in a diverse array of human cells. Sci Rep. 2014 May  29;4:5105. doi: 10.1038/srep05105.Add  to Cart

pAdSh.U6.gRNAS1U6.gRNAS1  cassette (Synthetic)Mammalian  Expression, Adenoviral, CRISPRGoncalvesAdenoviral vector delivery  of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in  a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi:  10.1038/srep05105.Add  to Cart

pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1sgRNA_PDS2-Cas9-sgRNA_PDS1  (Synthetic)Plant  Expression, CRISPRKamounPlant genome editing made  easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas  system. Plant Methods. 2013 Oct 11;9(1):39.Add  to Cart

pAN-ANDA1NT sgRNA  (Synthetic), A4NT sgRNA (Synthetic), A2NT sgRNA (Synthetic), A1NT (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-NORA2NT sgRNA  (Synthetic), A2NT sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-OR-MalT-3NTA2NT sgRNA  (Synthetic), Malt-3NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A1NTA1NT  (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart
pAN-PBAD-sgRNA-A1TA1T sgRNA  (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A2NTA2NT sgRNABacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A2TA2T sgRNA  (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A3NTA3NT sgRNA  (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A3TA3T sgRNA  (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A4NT  A4NT sgRNA (Synthetic)  Bacterial Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A4TA4T  sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A5NTA5NT  sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-A5TA5T  sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-scramblescramble  sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pAN-PBAD-sgRNA-VRVR  sgRNA (Synthetic)Bacterial  Expression, CRISPRVoigtMulti-input CRISPR/Cas  genetic circuits that interface host regulatory networks. Mol Syst Biol.  2014 Nov 24;10:763. doi: 10.15252/msb.20145735.Add  to Cart

pCASS.  pyogenese Cas9 (Other), RNA pol III promoter (tRNA-Tyr) (Saccharomyces  cerevisiae), hepatitis delta virus ribozyme, genomic (Other), sgRNA  (Synthetic)Bacterial  Expression, Yeast Expression, CRISPR, Synthetic BiologyCateSelection of chromosomal  DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3.  doi: 10.7554/eLife.03703.Add  to Cart

pCascas9  (Other)Bacterial  Expression, CRISPR ; Lambda Red recombinaseYangMultigene editing in the  Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ  Microbiol. 2015 Jan 30. pii: AEM.04023-14.Add  to Cart

pCCM935unc-22  sgRNA (Caenorhabditis elegans)Worm  ExpressionMelloA Co-CRISPR Strategy for  Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30.  pii: genetics.114.166389.Add  to Cart

pCCM936avr-14  sgRNA (Caenorhabditis elegans)Worm  Expression, CRISPRMelloA Co-CRISPR Strategy for  Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30.  pii: genetics.114.166389.Add  to Cart

pCCM937avr-15  sgRNA (Caenorhabditis elegans)Worm  Expression, CRISPRMelloA Co-CRISPR Strategy for  Efficient Genome Editing in Caenorhabditis elegans.Genetics. 2014 May 30.  pii: genetics.114.166389.Add  to Cart

pDR348 FANCFgRNA-FANCF  (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pDR366 RNF2gRNA-RNF2  (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pFYF1320 EGFP Site#1gRNA-EGFP  site 1 (Synthetic)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pFYF1327 EGFP Site#2gRNA-EGFP  site 2 (Synthetic)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pFYF1328 EGFP Site#3gRNA-EGFP  site 3 (Synthetic)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pFYF1548 EMX1gRNA-EMX1  (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pJA14rde-1(H974)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA42rol-6(su1006)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA45rde-1(D718)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA46rde-1(D801)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA50unc-58(e665)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA54sqt-1(e1350)  gRNA1 (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA55sqt-1(e1350)  gRNA2 (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJA59unc-109(n499)  gRNA (Caenorhabditis elegans)CRISPRFireEfficient Marker-Free  Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis  elegans.Genetics. 2014 Aug 26. pii: genetics.114.169730.Add  to Cart

pJW1219sgRNA(F+E)  (Synthetic)Worm  Expression, CRISPRWardRapid and Precise  Engineering of the Caenorhabditis elegans Genome with Lethal Mutation  Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9.  pii: genetics.114.172361.Add  to Cart

pJZC101sgRNA,  COM-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC102sgRNAMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC103sgRNAMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC116sgRNA + 2x  MS2 (wt+f6) binding module, MCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC25sgRNA + 1x  MS2 binding module, MCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC32sgRNA,  MCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC33sgRNA + 2x  MS2 binding module, MCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC34sgRNA + 2x  MS2(wt+f6) binding module, MCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC35sgRNAMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC39sgRNA + 1x  PP7, mCherryMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC40sgRNA + 2x  PP7, mCherryMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC41sgRNA,  PCP-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC48sgRNA + 1x  COM binding module, COM-VP64Mammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC523sgRNAYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC545sgRNA + 1x  MS2 binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC548sgRNA + 1x  PP7Yeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC572sgRNA + 1x  com RNA binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC583sgRNA + 2x  MS2 binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC588sgRNA + 2x  MS2 (wt+f6) binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC593sgRNA +  MS2-PP7 RNA binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC603sgRNA + 2x  PP7 RNA binding moduleYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC625sgRNA +1x  MS2, Pol II promoter with ribozyme cleavageYeast  ExpressionQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC73sgRNA,  COM-KRABMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC74sgRNA + 1x  COM binding module, COM-KRABMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC77sgRNA,  COM-KRABMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pJZC78sgRNA + 1x  COM binding module, COM-KRABMammalian  Expression, LentiviralQiEngineering Complex  Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014  Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.Add  to Cart

pLH-nmsgRNA1.1Nm  sgRNA1.1 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRPedersonMulticolor CRISPR labeling  of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.Add  to Cart

pLH-spsgRNA2Sp sgRNA2  (Synthetic)Mammalian  Expression, Lentiviral, CRISPRPedersonMulticolor CRISPR labeling  of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.Add  to Cart

pLH-stsgRNA1.1St1  sgRNA1.1 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRPedersonMulticolor CRISPR labeling  of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.Add  to Cart

pLH-stsgRNA2.1St1  sgRNA2.1 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRPedersonMulticolor CRISPR labeling  of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.Add  to Cart

pLH-stsgRNA3.1St1  sgRNA3.1 (Synthetic)Mammalian  Expression, Lentiviral, CRISPRPedersonMulticolor CRISPR labeling  of chromosomal loci in human cells.Proc Natl Acad Sci U S A. 2015 Mar  10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.Add  to Cart

pLKO.1-puro U6 sgRNA Oct4A -12Oct4A -12  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLKO.1-puro  U6 sgRNA Oct4A -158Oct4A -158  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLKO.1-puro U6 sgRNA SOX17 -126Sox17 -126  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLKO.1-puro U6 sgRNA SOX17 -177Sox17 -177  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLKO.1-puro U6 sgRNA SOX17 -296Sox17-296  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLKO.1-puro U6 sgRNA SOX17 -91Sox17 -91  sgRNA (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRWolfeCas9 effector-mediated  regulation of transcription and differentiation in human pluripotent stem  cells.Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.Add  to Cart

pLV-sgCDKN1B#2 BFPBFPMammalian  Expression, Lentiviral, CRISPRValeA Protein-Tagging System  for Signal Amplification in Gene Expression and Fluorescence  Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi:  10.1016/j.cell.2014.09.039.Add  to Cart

PM-SP!TABacterial  SP crRNA to prototspacer A (Synthetic)CRISPRChurchOrthogonal Cas9 proteins  for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29.  doi: 10.1038/nmeth.2681.Add  to Cart

PM-SP!TBBacterial  SP crRNA to prototspacer B (Synthetic)CRISPRChurchOrthogonal Cas9 proteins  for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29.  doi: 10.1038/nmeth.2681.Add  to Cart

pMM178Cas9,  tracrRNA, crRNA (Other)Bacterial  Expression, CRISPRLuSequence-specific  antimicrobials using efficiently delivered RNA-guided nucleases. Nat  Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.Add  to Cart

pMM441Cas9,  tracrRNA, crRNA (Other)Bacterial  Expression, CRISPRLuSequence-specific  antimicrobials using efficiently delivered RNA-guided nucleases. Nat  Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.Add  to Cart

pMZ284rrk1-sgRNA  (Schizosaccharomyces pombe)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart

pMZ285rrk1-sgRNA  (Schizosaccharomyces pombe)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart

pMZ286rrk1-sgRNA  (Schizosaccharomyces pombe)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart

pMZ288Cas9  (Other), rrk1:sgRNA (Other)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart

pMZ289Cas9  (Other), rrk1:sgRNA (Other)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart

pMZ381Cas9  (Other), rrk1:sgRNA (Other)Yeast  Expression, CRISPRZaratieguiImplementation of the  CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344.  doi: 10.1038/ncomms6344.Add  to Cart
pRC319Cas9,  tracrRNA, crRNA (Other)Bacterial  Expression, CRISPRLuSequence-specific  antimicrobials using efficiently delivered RNA-guided nucleases. Nat  Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.Add  to Cart

pRPR1_a1gRNA_RPR1ta1 gRNA  (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c1gRNA_RPR1tc1 gRNA  (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c2gRNA_RPR1tc2 gRNA  (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c3gRNA_RPR1tc3 gRNA  (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c5gRNA_RPR1t  c5 gRNA (Saccharomyces cerevisiae)  Yeast ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c6gRNA_RPR1tc6  gRNA (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c7gRNA_RPR1tc7  gRNA (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_c8gRNA_RPR1tc8  gRNA (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRPR1_g1gRNA_RPR1tg1  gRNA (Saccharomyces cerevisiae)Yeast  ExpressionLuTunable and  Multifunctional Eukaryotic Transcription Factors Based on  CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.Add  to Cart

pRS316-RGR-GFPRGR-GFP  (Synthetic)Bacterial  Expression, Yeast Expression, CRISPRZhaoSelf-processing of  ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi:  10.1111/jipb.12152.Add  to Cart

pRS316-RGR-GFP-mHDVRGR-GFP  (Synthetic)Bacterial  Expression, Yeast Expression, CRISPRZhaoSelf-processing of  ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi:  10.1111/jipb.12152.Add  to Cart

pRS316-RGR-GFP-mHHRGR-GFP  (Synthetic)Bacterial  Expression, Yeast Expression, CRISPRZhaoSelf-processing of  ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi:  10.1111/jipb.12152.Add  to Cart

pRS316-RGR-GFP-mmRGR-GFP  (Synthetic)Bacterial  Expression, Yeast Expression, CRISPRZhaoSelf-processing of  ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi:  10.1111/jipb.12152.Add  to Cart

pSAG1::CAS9-U6::sg290860-6CRISPR  sg290860-6CRISPR  ; ; Toxoplasma gondiiSibleyGenetic mapping reveals  that sinefungin resistance in Toxoplasma gondii is controlled by a putative  amino acid transporter locus that can be used as a negative selectable  marker. Eukaryot Cell. 2014 Dec 5. pii: EC.00229-14.Add  to Cart

pSNR52-sgTEF1sgTEF1  promoter (Saccharomyces cerevisiae)Yeast  Expression, CRISPRWeissmanCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pSNR52-sgTETsgTEF1  (Saccharomyces cerevisiae)Yeast  Expression, CRISPRWeissmanCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pT7-gRNA:AsipAgouti  signaling protein gRNA (Rattus norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7-gRNA:kit-1v-kit  Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus  norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7-gRNA:kit-2-1v-kit  Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus  norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7-gRNA:kit-2-2v-kit  Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus  norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7-gRNA:Tyr (albino)Tyrosinase  gRNA (Rattus norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7-gRNA:Tyr (wild)Tyrosinase  gRNA (Rattus norvegicus)CRISPRMashimoAllele-specific genome  editing and correction of disease-associated phenotypes in rats using the  CRISPR-Cas platform.Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.Add  to Cart

pT7ddx19gRNAddx19  gRNA (Danio rerio)CRISPRWenteEfficient multiplex  biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl  Acad Sci U S A. 2013 Aug 5.Add  to Cart

pT7goldRNAgolden  gRNA (Danio rerio)CRISPRChenEfficient multiplex  biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl  Acad Sci U S A. 2013 Aug 5.Add  to Cart

pT7mitfagRNAmitfa  gRNA (Danio rerio)CRISPRChenEfficient multiplex  biallelic zebrafish genome editing using a CRISPR nuclease system.Proc Natl  Acad Sci U S A. 2013 Aug 5.Add  to Cart

pTargetFsgRNA  (Synthetic)Bacterial  Expression, CRISPRYangMultigene editing in the  Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ  Microbiol. 2015 Jan 30. pii: AEM.04023-14.Add  to Cart

pU6-sgCD71-2sgCD71  -2 (Homo sapiens), Puromycin resistance and mCherryMammalian  Expression, Lentiviral, CRISPRQiCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pU6-sgGAL4-1sgGAL4-1,  Puromycin resistance and mCherryMammalian  Expression, Lentiviral, CRISPRQiCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pU6-sgGAL4-4sgGAL4-4,  Puromycin resistance and mCherryMammalian  Expression, Lentiviral, CRISPRQiCRISPR-Mediated Modular  RNA-Guided Regulation of Transcription in Eukaryotes.Cell. 2013 Jul 9. pii:  S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.Add  to Cart

pU6a:sgRNA(tyr)U6a:sgRNA  (tyr) (Danio rerio)CRISPRChenMultiplex Conditional  Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics.  2015 Apr 8. pii: genetics.115.176917.Add  to Cart

pVC228 VEGF Site#3gRNA-VEGF  site 3 (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pVC297 VEGF Site#1gRNA-VEGF  site 1 (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pVC299 VEGF Site#2gRNA-VEGF  site 2 (Homo sapiens)Mammalian  Expression, CRISPRJoungHigh-frequency off-target  mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat  Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.Add  to Cart

pX330 Ctnnb1.1Ctnnb1  (Mus musculus)Mammalian  Expression, CRISPRJacksCRISPR-mediated direct  mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi:  10.1038/nature13589.Add  to Cart

pX330 Ctnnb1.2Ctnnb1  (Mus musculus)Mammalian  Expression, CRISPRJacksCRISPR-mediated direct  mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi:  10.1038/nature13589.Add  to Cart

pX330 p53p53  (Mus musculus)Mammalian  Expression, CRISPRJacksCRISPR-mediated direct  mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi:  10.1038/nature13589.Add  to Cart

pX330 PtenPten  (Mus musculus)Mammalian  Expression, CRISPRJacksCRISPR-mediated direct  mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi:  10.1038/nature13589.Add  to Cart

px330-gp78gp78  (Homo sapiens)CRISPRYeUSP13 antagonizes gp78 to  maintain functionality of a chaperone in ER-associated  degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014  Jan 14.Add  to Cart

px330-USP13USP13  (Homo sapiens)CRISPRYeUSP13 antagonizes gp78 to  maintain functionality of a chaperone in ER-associated  degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014  Jan 14.Add  to Cart

pX330A-1x3humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A-1x4humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A-1x5humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A-1x6humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A-1x7humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x2humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x3humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x4humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x5humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x6humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330A_D10A-1x7humanized  S. pyogenes Cas9 (D10A) nickase (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-3humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-4humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-5humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-6humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

pX330S-7humanized  S. pyogenes Cas9 nuclease (Other)Mammalian  Expression, CRISPRYamamotoMultiplex genome  engineering in human cells using all-in-one CRISPR/Cas9 vector  system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.Add  to Cart

px335 Mettl14 sgRNA #1gcggcagctcctagctcagc  (Mus musculus)Mammalian  Expression, CRISPRHannam6A mRNA methylation  facilitates resolution of naïve pluripotency toward  differentiation. Science 1 January 2015Add  to Cart

px335 Mettl14 sgRNA #2gccgctcccggatctcctgc  (Mus musculus)Mammalian  Expression, CRISPRHannam6A mRNA methylation  facilitates resolution of naïve pluripotency toward  differentiation. Science 1 January 2015Add  to Cart

RFN_EGFP_47pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

RFN_EGFP_80pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

RFN_EGFP_81pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

RFN_EGFP_82pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

RFN_EGFP_83pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

RFN_EGFP_84pair  of multiplex gRNAs targeting EGFPMammalian  Expression, CRISPRJoungDimeric CRISPR RNA-guided  FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014  Apr 25. doi: 10.1038/nbt.2908.Add  to Cart

sgRNA1_ASCL1sgRNA1_ASCL1  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA1_GAL4UAS-Luciferase reportersgRNA1  for GAL4UAS-Luciferase reporter (Synthetic)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA1_IL1RNIL1RN  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA1_MYOD1sgRNA1_MYOD1  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA1_NANOGsgRNA1_NANOG  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA2_ASCL1sgRNA1_ASCL2  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA2_GAL4UAS-Luciferase reportersgRNA2  for GAL4UAS-Luciferase reporter (Synthetic)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA2_IL1RNsgRNA2_IL1RN  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA2_MYOD1sgRNA1_MYOD1  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA2_NANOGsgRNA2_NANOG  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA3_ASCL1sgRNA1_ASCL3  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA3_GAL4UAS-Luciferase reportersgRNA3  for GAL4UAS-Luciferase reporter (Synthetic)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA3_IL1RNsgRNA3_IL1RN  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA3_MYOD1sgRNA1_MYOD1  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA3_NANOGsgRNA3_NANOG  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA4_ASCL1sgRNA1_ASCL4  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA4_IL1RNsgRNA4_IL1RN  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA4_MYOD1sgRNA1_MYOD1  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

sgRNA4_NANOGsgRNA4_NANOG  (Homo sapiens)Mammalian  Expression, Lentiviral, CRISPRSatoCRISPR-Cas9-based  Photoactivatable Transcription System. Chem Biol. 2015 Feb  19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.Add  to Cart

U6>Control(F+E)Control  (F+E) sgRNACRISPRChristiaenTissue-specific genome  editing in Ciona embryos by CRISPR/Cas9. Development. 2014  Nov;141(21):4115-20. doi: 10.1242/dev.114488.Add  to Cart

U6>Ebf.774(F+E)Ebf.774  (F+E) sgRNACRISPRChristiaenTissue-specific genome  editing in Ciona embryos by CRISPR/Cas9. Development. 2014  Nov;141(21):4115-20. doi: 10.1242/dev.114488.Add  to Cart

Zebrafish-gRNA-0001gRNA-apoea  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0002gRNA-drd3  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0003gRNA-fh  site #1 (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0004gRNA-fh  site #2 (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0005gRNA-gsk3b  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0006gRNA-rgs4  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0007gRNA-th1  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0008gRNA-tia1l  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart

Zebrafish-gRNA-0009gRNA-tph1a  (Danio rerio)CRISPR  ; zebrafish expressionJoungEfficient genome editing  in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29.  doi: 10.1038/nbt.2501.Add  to Cart
Empty  gRNA Vectors






Select a gRNA expression plasmid based  on factors such as selectable marker or cloning method. When using the  CRISPR/Cas system, you will need to express both a Cas9 protein and a  target-specific gRNA in the same cell at the same time. Single plasmids containing  both the gRNA and Cas9 act as an all-in-one vector, but their function (cut,  nick, activate, interfere...) is limited to that of the Cas9 present on the  plasmid. gRNA plasmids that do not co-express Cas9 require a separate plasmid  that does so; however, these independent gRNA plasmids can be paired with a  wide variety of Cas9 plasmids and therefore are not limited to a single Cas9  function.
Mammalian






gRNA  PlasmidPromoterCloning DeliverySelectionCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

gRNA_Cloning VectorhU6AfIIITransfectionBleocinnone, need Cas9 plasmidChurch

pSPgRNAhU6BbsITransfection
none, need Cas9 plasmidGersbach

phH1-gRNAhuman H1BbsITransfection
none, need Cas9 plasmidGersbach

pmU6-gRNAmouse U6BbsITransfection
none, need Cas9 plasmidGersbach

phU6-gRNAhuman U6BbsITransfection
none, need Cas9 plasmidGersbach

ph7SK-gRNAhuman 7SKBbsITransfection
none, need Cas9 plasmidGersbach

pGL3-U6-sgRNA-PGK-puromycinhU6
TransfectionPuromycinnone, need Cas9 plasmidHuang

pUC57-sgRNA expression vectorT7BsaIIn vitro transcription
none, need Cas9 plasmidHuang

pAC155-pCR8-sgExpressionhU6BbsITransfection
none, need Cas9 plasmidJaenisch

pAC154-dual-dCas9VP160-sgExpressionhU6BbsITransfection
yes, activateJaenisch

pAC153-dual-dCas9VP96-sgExpressionhU6BbsITransfection
yes, activateJaenisch

pAC152-dual-dCas9VP64-sgExpressionhU6BbsITransfection
yes, activateJaenisch

pAC5-dual-dCas9VP48-sgTetOhU6BbsITransfection
yes, activateJaenisch

pAC2-dual-dCas9VP48-sgExpressionhU6BbsITransfection
yes, activateJaenisch

MLM3636hU6BsmBITransfection
none, need Cas9 plasmidJoung

pSQT1313hU6BsmBITransfection
none, need Cas9 plasmidJoung

pU6_gRNA_handle_U6tU6SacITransfectionEBFPnone, need Cas9 plasmidLu

pgRNA-humanizedmU6BstXI + XhoILentiviralPuromycin, none, need Cas9 plasmidQi
mCherry

pLX-sgRNAhU6See paperLentiviralBlasticidinnone, need Cas9 plasmidSabatini  and
Lander

pLenti-sgRNA-LibhU6BsmBILentiviralccdBnone, need Cas9 plasmidWei

pLKO.1-puro U6 sgRNA BfuAI stufferhU6BfuAILentiviralPuromycinnone, need Cas9 plasmidWolfe

pLKO.1-puro U6 sgRNA BfuAI large stufferhU6BfuAILentiviralPuromycinnone, need Cas9 plasmidWolfe

pKLV-U6gRNA(BbsI)-PGKpuro2ABFPhU6BbsILentiviralPuromycin, none, need Cas9 plasmidYusa
TagBFP

lentiGuide-PurohU6BsmBILentiviralPuromycinnone, need Cas9 plasmidZhang

lentiCRISPR v2hU6BsmBILentiviralPuromycinyes, cutZhang

PX462 (3rd Gen)hU6BbsITransfectionPuromycinyes, nick (D10A)Zhang

PX461 (3rd Gen)hU6BbsITransfectionEGFPyes, nick (D10A)Zhang

PX460 (3rd Gen)hU6BbsITransfection
yes, nick (D10A)Zhang

PX459 (3rd Gen)hU6BbsITransfectionPuromycinyes, cutZhang

PX458 (3rd Gen)hU6BbsITransfectionEGFPyes, cutZhang

PX335 (2nd Gen)hU6BbsITransfection
yes, nick (D10A)Zhang

PX334 (1st Gen)hU6BbsITransfectionPuromycinyes, nick (D10A)Zhang

PX330 (2nd Gen)hU6BbsITransfection
yes, cutZhang

PX260 (1st Gen)hU6BbsITransfectionPuromycinyes, cutZhang
Cas9 species = N.  meningitidis (PAM = NNNNGATT)

pSmart-Nm-sgRNA-BbsIhU6BbsITransfection
none, need Cas9 plasmidThomson  and
Sontheimer

pSimpleII-U6-tracr-hU6BsmBITransfection
yes, cutThomson  and
U6-BsmBI-NLS-Sontheimer
NmCas9-HA-NLS(s)
Bacteria






gRNA  PlasmidPromoterCloning Validated  InResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pCRISPR
BsaIE.  coli, Chloramphenicolnone, need Cas9 plasmidMarraffini
S. pneumoniae

pCas9
BsaIE.  coli, Chloramphenicolyes, cutMarraffini
S. pneumoniae

pgRNA-bacteriaBBa_J23119SpeI + HindIII
Ampicillinnone, need Cas9 plasmidQi
Drosophila






gRNA  PlasmidPromoterCloning DeliveryResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pCFD1-dU6:1gRNAdU6:1BbsIInjection  or in vitrotranscriptionVirmilionnone, need Cas9 plasmidBullock and  Port

pCFD2-dU6:2gRNAdU6:2BbsIInjection  or in vitrotranscriptionVirmilionnone, need Cas9 plasmidBullock and Port

pCFD3-dU6:3gRNAdU6:3BbsIInjection  or in vitrotranscriptionVirmilionnone, need Cas9 plasmidBullock and  Port

pCFD4-U6:1_U6:3tandemgRNAsdU6:1 and dU6:3BbsIInjection  or in vitrotranscriptionVirmilionnone, need Cas9 plasmidBullock and Port

pRB17U6blunt end cloningInjection  or in vitrotranscription
none, need Cas9 plasmidFoerstemann

pAc-sgRNA-Cas9dU6BspQITransfectionPuromycinyes, cutJi-Long  Liu

U6-BbsI-crRNAdU6BbsITransfection
none, need Cas9 plasmidO'Connor-Giles,
Harrison, Wildonger

pU6-BbsI-chiRNAdU6BbsITransfection
none, need Cas9 plasmidO'Connor-Giles,
Harrison, Wildonger
C. elegans






gRNA  PlasmidPromoterCloning DeliveryResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

sgRNA with U6 promotercU6HindIIIInjection
none, need Cas9 plasmidde Bono

sgRNA with rpr-1 promoterrpr-1EcoRIInjection
none, need Cas9 plasmidde  Bono

pMB70cU6BsaITransfection
none, need Cas9 plasmidBoxem

pMB60T7BsaIIn vitro transcription
none, need Cas9 plasmidBoxem

PU6::klp-12_sgRNAcU6PCR (see paper)Transfection
none, need Cas9 plasmidCalarco

pDD162 (Peft-3::Cas9 + Empty sgRNA)R07E5.16 U6


yes, cutGoldstein

DR274T7BsaIIn vitro transcription
none, need Cas9 plasmidJoung

SP6-sgRNA-scaffoldSP6AflIIIn vitro transcription
none, need Cas9 plasmidSternberg
Plant






gRNA  PlasmidPromoterCloning Validated  InResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pICSL01009::AtU6paU6BsaIArabidopsis
none, need Cas9 plasmidKamoun

pFGC-pcoCas9noneAscI, PacI, SbfIArabidopsis
yes, cutSheen

pUC119-gRNAU6PCR templateArabidopsis
none, need Cas9 plasmidSheen

pRGEB31rice snoRNA U3BsaIArabidopsis
none, need Cas9 plasmidYang

pRGE31rice snoRNA U3BsaIArabidopsis
none, need Cas9 plasmidYang
Yeast






gRNA  PlasmidPromoterCloning Validated  InResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pRPR1_gRNA_pRPR1HindIIIS. cerevisiaeLEU2none, need Cas9 plasmidLu
handle_RPR1t
Zebrafish






gRNA  PlasmidPromoterCloning DeliveryResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pT7-gRNAT7BsmBIIn vitro transcription
none, need Cas9 plasmidChen and Wente

DR274T7BsaIIn vitro transcription
none, need Cas9 plasmidJoung
Xenopus






gRNA  PlasmidPromoterCloning DeliveryResistanceCo-expressed  Cas9Depositing  lab
Enzyme(s)








Cas9 species = S.  pyogenes (PAM = NGG)

pUC57-Simple-gRNA backboneT7BsaIIn vitrotranscription
none, need Cas9 plasmidChen









您正在向 biovector.net  发送关于产品 CRISPR/Cas9系统质粒载体列表2-BioVector NTCC保藏中心 的询问

点击“立即发送”后,我们将在1个工作日内与您取得联系。

 

可以介绍下你们的产品么

你们是怎么收费的呢

现在有优惠活动吗